shRNA Adeno-associated Virus Serotype 2, pU6-(FBXL16-shRNA-Seq1)(CAT#: AAV-SI1513WQ)
This product is a FBXL16-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by FBXL16 belongs to the F-box protein family and they interact with ubiquitination targets through other protein interaction domains. The expression of FBXL16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | FBXL16-shRNA-Seq1 |
Related Target/Protein | FBXL16 |
Region | CDS |
TargetSeq | CCTGGACATCTGTGAGTTCAT |
NCBI RefSeq | NM_153350 |
Alternative Names | Fbl16; C16orf22; c380A1.1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Ductal Carcinoma |