shRNA Adeno-associated Virus Serotype 2, pU6-(Gramd1a-shRNA-Seq1)(CAT#: AAV-SI2214WQ)
This product is a Gramd1a-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Gramd1a gene is cholesterol transporter that mediates non-vesicular transport of cholesterol from the plasma membrane (PM) to the endoplasmic reticulum (ER). The expression of Gramd1a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Gramd1a-shRNA-Seq1 |
Related Target/Protein | Gramd1a |
Region | CDS |
TargetSeq | CGAAGATTATTTCCACCACCT |
NCBI RefSeq | NM_027898 |
Titer | >1*10^10 GC/mL |
Related Diseases | Cancer |