shRNA Adeno-associated Virus Serotype 2, pU6-(Gramd1a-shRNA-Seq1)(CAT#: AAV-SI2214WQ)

This product is a Gramd1a-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Gramd1a gene is cholesterol transporter that mediates non-vesicular transport of cholesterol from the plasma membrane (PM) to the endoplasmic reticulum (ER). The expression of Gramd1a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Gramd1a-shRNA-Seq1
Related Target/Protein Gramd1a
Region CDS
TargetSeq CGAAGATTATTTCCACCACCT
NCBI RefSeq NM_027898
Titer >1*10^10 GC/mL
Related Diseases Cancer
Target Gene
Gene ID 57655
Uniprot ID Q96CP6

Related Products

Inquiry Now
Advertisement