shRNA Adeno-associated Virus Serotype 2, pU6-(Gvin1-shRNA-Seq1)(CAT#: AAV-SI1753WQ)
This product is a Gvin1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Gvin1 gene belongs to the TRAFAC class dynamin-like GTPase superfamily. The expression of Gvin1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Gvin1-shRNA-Seq1 |
Related Target/Protein | Gvin1 |
Region | 3UTR |
TargetSeq | GAGGATCTGCAGTAGACATTT |
NCBI RefSeq | NM_029000 |
Alternative Names | GVIN1; VLIG1; GVIN1P; VLIG-1; GVINP1 |
Titer | >1*10^10 GC/mL |