shRNA Adeno-associated Virus Serotype 2, pU6-(Lamtor2-shRNA-Seq1)(CAT#: AAV-SI2346WQ)
This product is a Lamtor2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Lamtor2 gene is highly conserved with a mouse protein associated with the cytoplasmic face of late endosomes and lysosomes. The expression of Lamtor2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Lamtor2-shRNA-Seq1 |
Related Target/Protein | Lamtor2 |
Region | CDS |
TargetSeq | GCTGAATAATGAGGGATCGCT |
NCBI RefSeq | NM_031248 |
Alternative Names | p14; ENDAP; ROBLD3; HSPC003; MAPBPIP; MAPKSP1AP; Ragulator2 |
Titer | >1*10^10 GC/mL |
Related Diseases | Primary immunodeficiency syndrome |