shRNA Adeno-associated Virus Serotype 2, pH1-(BEST1-shRNA-Seq2)(CAT#: AAV-SI0737WQ)

This product is a BEST1-shRNA encoding AAV, which is based on AAV-2 serotype. The BEST1 gene encodes a member of the bestrophin gene family. This small gene family is characterized by proteins with a highly conserved N-terminus with four to six transmembrane domains. The expression of BEST1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert BEST1-shRNA-Seq2
Related Target/Protein BEST1
Region 3UTR
TargetSeq GCCTGAATCAAATGGTTAGCT
NCBI RefSeq NM_004183
Alternative Names ARB; BMD; BEST; RP50; VMD2; TU15B; Best1V1Delta2
Titer >1*10^10 GC/mL
Related Diseases Macular Dystrophy
Target Gene
Gene ID 7439
Uniprot ID O76090

Related Products

Advertisement