shRNA Adeno-associated Virus Serotype 2, pU6-(LOC441799-shRNA-Seq4)(CAT#: AAV-SI1575WQ)

This product is a LOC441799-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of LOC441799-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert LOC441799-shRNA-Seq4
Related Target/Protein LOC441799
Region CDS
TargetSeq GTGTACTTGCTCAGTTTCCCT
NCBI RefSeq XM_497554
Titer >1*10^10 GC/mL

Related Products