shRNA Adeno-associated Virus Serotype 2, pU6-(Mepe-shRNA-Seq1)(CAT#: AAV-SI2304WQ)
This product is a Mepe-shRNA encoding AAV, which is based on AAV-2 serotype. The Mepe gene encodes a secreted calcium-binding phosphoprotein that belongs to the small integrin-binding ligand, N-linked glycoprotein (SIBLING) family of proteins. The expression of Mepe-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Mepe-shRNA-Seq1 |
Related Target/Protein | Mepe |
Region | CDS |
TargetSeq | GCTCCAGCAAAGCTGAAGTTA |
NCBI RefSeq | NM_053172 |
Alternative Names | OF45 |
Titer | >1*10^10 GC/mL |
Related Diseases | Aging-related trabecular bone loss |