shRNA Adeno-associated Virus Serotype 2, pU6-(Mettl4-shRNA-Seq3)(CAT#: AAV-SI1848WQ)

This product is a Mettl4-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Mettl4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Mettl4-shRNA-Seq3
Related Target/Protein Mettl4
Region 3UTR
TargetSeq CTGTCTTTACCTCAGCTCCTT
NCBI RefSeq NM_176917
Alternative Names HsT661
Titer >1*10^10 GC/mL
Target Gene
Gene ID 64863
Uniprot ID Q8N3J2

Related Products

Inquiry Now
Advertisement