shRNA Adeno-associated Virus Serotype 2, pU6-(Olfr380-shRNA-Seq1)(CAT#: AAV-SI2258WQ)

This product is a Olfr380-shRNA encoding AAV, which is based on AAV-2 serotype. The Olfr380 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr380-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Olfr380-shRNA-Seq1
Related Target/Protein Olfr380
Region CDS
TargetSeq GCTGCCTGACACAAATGTACT
NCBI RefSeq NM_147025
Alternative Names MOR135-1
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 259027
Uniprot ID Q8VGT3

Related Products

Advertisement