shRNA Adeno-associated Virus Serotype 2, pU6-(OR5H1-shRNA-Seq4)(CAT#: AAV-SI1539WQ)

This product is a OR5H1-shRNA encoding AAV, which is based on AAV-2 serotype. The OR5H1 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR5H1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert OR5H1-shRNA-Seq4
Related Target/Protein OR5H1
Region CDS
TargetSeq GCTGAATAACTTCTTAGCTAA
NCBI RefSeq NM_001005338
Alternative Names HTPCRX14; HSHTPCRX14
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 26341
Uniprot ID A6NKK0

Related Products

Advertisement