shRNA Adeno-associated Virus Serotype 2, pU6-(Pea15b-shRNA-Seq1)(CAT#: AAV-SI2341WQ)

This product is a Pea15b-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Pea15b-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Pea15b-shRNA-Seq1
Related Target/Protein Pea15b
Region CDS
TargetSeq GAGAAGACTGAGGAGATCACT
NCBI RefSeq NM_001010832
Titer >1*10^10 GC/mL
Target Gene
Gene ID 231332
Uniprot ID Q5QHR8

Related Products

Advertisement