shRNA Adeno-associated Virus Serotype 2, pU6-(PLEKHM1-shRNA-Seq2)(CAT#: AAV-SI0431WQ)
This product is a PLEKHM1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by PLEKHM1 gene is essential for bone resorption, and may play a critical role in vesicular transport in the osteoclast. The expression of PLEKHM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | PLEKHM1-shRNA-Seq2 |
Related Target/Protein | PLEKHM1 |
Region | CDS |
TargetSeq | CCTAAACTCTGATAGCTGCTT |
NCBI RefSeq | NM_014798 |
Alternative Names | B2; AP162; OPTA3; OPTB6 |
Titer | >1*10^10 GC/mL |
Related Diseases | Autosomal recessive osteopetrosis type 6 (OPTB6) |