shRNA Adeno-associated Virus Serotype 2, pU6-(SF3B4-shRNA-Seq5)(CAT#: AAV-SI0043WQ)

This product is a SF3B4-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by SF3B4 gene cross-links to a region in the pre-mRNA immediately upstream of the branchpoint sequence in pre-mRNA in the prespliceosomal complex A. It also may be involved in the assembly of the B, C and E spliceosomal complexes. In addition to RNA-binding activity, this protein interacts directly and highly specifically with subunit 2 of the splicing factor 3B. The expression of SF3B4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SF3B4-shRNA-Seq5
Related Target/Protein SF3B4
Region CDS
TargetSeq GAAGCCAATACGGGTGAACAA
NCBI RefSeq NM_005850
Alternative Names AFD1; Hsh49; SAP49; SF3b49
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular carcinoma
Target Gene
Gene ID 10262
Uniprot ID Q15427

Related Products