shRNA Adeno-associated Virus Serotype 2, pH1-(FAM124A-shRNA-Seq2)(CAT#: AAV-SI0787WQ)

This product is a FAM124A-shRNA encoding AAV, which is based on AAV-2 serotype. FAM124A belongs to the FAM124 family. The expression of FAM124A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert FAM124A-shRNA-Seq2
Related Target/Protein FAM124A
Region CDS
TargetSeq GAAAGCGGACTTCTGCATCTT
NCBI RefSeq NM_145019
Titer >1*10^10 GC/mL
Related Diseases Mycoplasma pneumoniae pneumonia
Target Gene
Gene ID 220108
Uniprot ID Q86V42

Related Products