shRNA Adeno-associated Virus Serotype 2, pU6-(SPEM1-shRNA-Seq1)(CAT#: AAV-SI2187WQ)

This product is a SPEM1-shRNA encoding AAV, which is based on AAV-2 serotype. The SPEM1 gene is required for proper cytoplasm removal during spermatogenesis. The expression of SPEM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SPEM1-shRNA-Seq1
Related Target/Protein SPEM1
Region 3UTR
TargetSeq GTGAACTCAGAAACTGAGAAA
NCBI RefSeq NM_199339
Alternative Names C17orf83
Titer >1*10^10 GC/mL
Target Gene
Gene ID 374768
Uniprot ID Q8N4L4

Related Products

Inquiry Now
Advertisement