shRNA Adeno-associated Virus Serotype 2, pU6-(TMEM205-shRNA-Seq2)(CAT#: AAV-SI0341WQ)

This product is a TMEM205-shRNA encoding AAV, which is based on AAV-2 serotype. Elevated expression of TMEM205, a hypothetical membrane protein, is associated with cisplatin resistance. The expression of TMEM205-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert TMEM205-shRNA-Seq2
Related Target/Protein TMEM205
Region CDS
TargetSeq GATGGTCCATCTACTGGTCTT
NCBI RefSeq NM_198536
Alternative Names UNQ501
Titer >1*10^10 GC/mL
Related Diseases Ovarian cancer
Target Gene
Gene ID 374882
Uniprot ID Q6UW68

Related Products

Advertisement