shRNA Adeno-associated Virus Serotype 2, pU6-(TTC1-shRNA-Seq1)(CAT#: AAV-SI0144WQ)

This product is a TTC1-shRNA encoding AAV, which is based on AAV-2 serotype. The TTC1 gene encoded protein plays a role in protein-protein interactions, and binds to the Galpha subunit of G protein-coupled receptors to activate the Ras signaling pathway. The expression of TTC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert TTC1-shRNA-Seq1
Related Target/Protein TTC1
Region CDS
TargetSeq CGGCTCGTACTCCATCAATTT
NCBI RefSeq NM_003314
Alternative Names TPR1
Titer >1*10^10 GC/mL
Related Diseases Medullary Thyroid Cancer
Target Gene
Gene ID 7265
Uniprot ID Q99614

Related Products