shRNA Adeno-associated Virus Serotype 2, pU6-(TXNDC5-shRNA-Seq1)(CAT#: AAV-SI1616WQ)
This product is a TXNDC5-shRNA encoding AAV, which is based on AAV-2 serotype. The TXNDC5 gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The expression of TXNDC5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | TXNDC5-shRNA-Seq1 |
Related Target/Protein | TXNDC5 |
Region | CDS |
TargetSeq | CGAAACTGTCAAGATTGGCAA |
NCBI RefSeq | NM_022085 |
Alternative Names | HCC2; ERP46; HCC-2; STRF8; PDIA15; UNQ364; ENDOPDI |
Titer | >1*10^10 GC/mL |
Related Diseases | Disulfide-isomerase deficiency |