shRNA Adeno-associated Virus Serotype 2, pU6-(TXNDC5-shRNA-Seq1)(CAT#: AAV-SI1616WQ)

This product is a TXNDC5-shRNA encoding AAV, which is based on AAV-2 serotype. The TXNDC5 gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The expression of TXNDC5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert TXNDC5-shRNA-Seq1
Related Target/Protein TXNDC5
Region CDS
TargetSeq CGAAACTGTCAAGATTGGCAA
NCBI RefSeq NM_022085
Alternative Names HCC2; ERP46; HCC-2; STRF8; PDIA15; UNQ364; ENDOPDI
Titer >1*10^10 GC/mL
Related Diseases Disulfide-isomerase deficiency
Target Gene
Gene ID 81567
Uniprot ID Q8NBS9

Related Products