shRNA Adeno-associated Virus Serotype 2, pU6-(Vmn1r85-shRNA-Seq2)(CAT#: AAV-SI1990WQ)

This product is a Vmn1r85-shRNA encoding AAV, which is based on AAV-2 serotype. The Vmn1r85 gene has pheromone binding and pheromone receptor activity. The expression of Vmn1r85-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Vmn1r85-shRNA-Seq2
Related Target/Protein Vmn1r85
Region CDS
TargetSeq GTTCATCAACATGGTCATATA
NCBI RefSeq NM_145847
Alternative Names V1rj3
Titer >1*10^10 GC/mL
Target Gene
Gene ID 252909
Uniprot ID Q8VIB8

Related Products

Inquiry Now
Advertisement