shRNA Adeno-associated Virus Serotype 2, pU6-(ZER1-shRNA-Seq1)(CAT#: AAV-SI1662WQ)
This product is a ZER1-shRNA encoding AAV, which is based on AAV-2 serotype. The ZER1 gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The expression of ZER1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | ZER1-shRNA-Seq1 |
| Related Target/Protein | ZER1 |
| Region | CDS |
| TargetSeq | CATAGGAATATGCTAGGACTT |
| NCBI RefSeq | NM_006336 |
| Alternative Names | ZYG; C9orf60; ZYG11BL |
| Titer | >1*10^10 GC/mL |
