shRNA Adeno-associated Virus Serotype 2, pU6-(Zfp36l2-shRNA-Seq1)(CAT#: AAV-SI2277WQ)

This product is a Zfp36l2-shRNA encoding AAV, which is based on AAV-2 serotype. The Zfp36l2 gene is a member of the TIS11 family of early response genes. The expression of Zfp36l2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Zfp36l2-shRNA-Seq1
Related Target/Protein Zfp36l2
Region CDS
TargetSeq CAAACCTCAATCTGAACAACA
NCBI RefSeq NM_001001806
Alternative Names BRF2; ERF2; ERF-2; TIS11D; RNF162C
Titer >1*10^10 GC/mL
Related Diseases T-cell acute lymphoblastic leukemia (T-ALL)
Target Gene
Gene ID 678
Uniprot ID P47974

Related Products

Inquiry Now
Advertisement