shRNA Adeno-associated Virus Serotype 2, pH1-(C16orf62-shRNA-Seq3)(CAT#: AAV-SI0988WQ)
This product is a C16orf62-shRNA encoding AAV, which is based on AAV-2 serotype. The C16orf62 gene acts as component of the retriever complex. The expression of C16orf62-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | C16orf62-shRNA-Seq3 |
| Related Target/Protein | C16orf62 |
| Region | CDS |
| TargetSeq | CATAGACAAAGTGGACTCCAA |
| NCBI RefSeq | NM_020314 |
| Alternative Names | VPS35L |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hepatocellular carcinoma |
