shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(BBS5-shRNA-Seq1)(CAT#: AdV-SI3211WQ)

This product is a BBS5-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The BBS5 gene encodes a protein that has been directly linked to Bardet-Biedl syndrome. The primary features of this syndrome include retinal dystrophy, obesity, polydactyly, renal abnormalities and learning disabilities. The expression of BBS5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert BBS5-shRNA-Seq1
Related Target/Protein BBS5
Region CDS
TargetSeq CAGGGCAATTTAGGAACCTTT
NCBI RefSeq NM_152384
Titer >1*10^10 GC/mL
Related Diseases Bardet-Biedl syndrome
Target Gene
Gene ID 129880
Uniprot ID Q8N3I7

Related Products