shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(BC027231-shRNA-Seq5)(CAT#: AdV-SI3687WQ)
This product is a BC027231-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The BC027231 gene may play a role in cortex development as part of the Notch signaling pathway. The expression of BC027231-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | BC027231-shRNA-Seq5 |
Related Target/Protein | BC027231 |
Region | 3UTR |
TargetSeq | CCTTGTGTAAGCTAATCACAT |
NCBI RefSeq | NM_145972 |
Alternative Names | Nepro |
Titer | >1*10^10 GC/mL |
Related Diseases | Neuronal differentiation and embryo development |