shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(C21orf2-shRNA-Seq1)(CAT#: AdV-SI1354WQ)
This product is a C21orf2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C21orf2 gene is down-regulated in Down syndrome (DS) brain, which may represent mitochondrial dysfunction in DS patients. The expression of C21orf2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | C21orf2-shRNA-Seq1 |
Related Target/Protein | C21orf2 |
Region | 3UTR |
TargetSeq | GTTGTGACAGTCTTCCTGAAA |
NCBI RefSeq | NM_004928 |
Alternative Names | RDMS; SMDAX; LRRC76; YF5/A2; CFAP410 |
Titer | >1*10^10 GC/mL |
Related Diseases | Amyotrophic lateral sclerosis, Down syndrome (DS) brain |