shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(BC003266-shRNA-Seq1)(CAT#: AdV-SI2298WQ)
This product is a Smim12-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of Smim12-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | BC003266-shRNA-Seq1 |
| Related Target/Protein | BC003266 |
| Region | 3UTR |
| TargetSeq | CCTGTGTGCATTCTTCCCTTT |
| NCBI RefSeq | NM_030252 |
| Alternative Names | Smim12 |
| Titer | >1*10^10 GC/mL |
