shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(CEP76-shRNA-Seq1)(CAT#: AdV-SI1239WQ)

This product is a CEP76-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The CEP76 gene encodes a centrosomal protein which regulates centriole amplification by limiting centriole duplication to once per cell cycle. The expression of CEP76-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert CEP76-shRNA-Seq1
Related Target/Protein CEP76
Region CDS
TargetSeq CACATTTAAAGGGTTCCCAAT
NCBI RefSeq NM_024899
Alternative Names C18orf9; HsT1705
Titer >1*10^10 GC/mL
Related Diseases Centriole reduplication
Target Gene
Gene ID 79959
Uniprot ID Q8TAP6

Related Products