shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(JOSD2-shRNA-Seq2)(CAT#: AdV-SI0873WQ)
This product is a JOSD2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The JOSD2 gene encodes a protein containing a Josephin domain. Josephin domain-containing proteins are deubiquitinating enzymes which catalyze the hydrolysis of the bond between the C-terminal glycine of the ubiquitin peptide and protein substrates. The expression of JOSD2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | JOSD2-shRNA-Seq2 |
Related Target/Protein | JOSD2 |
Region | CDS |
TargetSeq | GTGTCTACTACAACCTGGACT |
NCBI RefSeq | NM_138334 |
Alternative Names | SBBI54 |
Titer | >1*10^10 GC/mL |