shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Csprs-shRNA-Seq1)(CAT#: AdV-SI3708WQ)

This product is a Csprs-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of Csprs-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Csprs-shRNA-Seq1
Related Target/Protein Csprs
Region CDS
TargetSeq CCATTGTCATTATCGCAATAG
NCBI RefSeq NM_033616
Alternative Names HSR; D1Lub1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 114564
Uniprot ID Q99388

Related Products