shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(CXXC4-shRNA-Seq1)(CAT#: AdV-SI1176WQ)
This product is a CXXC4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The CXXC4 gene encodes a CXXC-type zinc finger domain-containing protein that functions as an antagonist of the canonical wingless/integrated signaling pathway. The expression of CXXC4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | CXXC4-shRNA-Seq1 |
Related Target/Protein | CXXC4 |
Region | CDS |
TargetSeq | CCGTCGTTGCAAATGGCAAAT |
NCBI RefSeq | NM_025212 |
Alternative Names | IDAX |
Titer | >1*10^10 GC/mL |
Related Diseases | Renal carcinoma |