shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(CXXC4-shRNA-Seq1)(CAT#: AdV-SI1176WQ)

This product is a CXXC4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The CXXC4 gene encodes a CXXC-type zinc finger domain-containing protein that functions as an antagonist of the canonical wingless/integrated signaling pathway. The expression of CXXC4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert CXXC4-shRNA-Seq1
Related Target/Protein CXXC4
Region CDS
TargetSeq CCGTCGTTGCAAATGGCAAAT
NCBI RefSeq NM_025212
Alternative Names IDAX
Titer >1*10^10 GC/mL
Related Diseases Renal carcinoma
Target Gene
Gene ID 80319
Uniprot ID Q9H2H0

Related Products