shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(GLOD4-shRNA-Seq1)(CAT#: AdV-SI1144WQ)
This product is a GLOD4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. Transfection of GLOD4 gene in hepatocellular carcinoma cells and overexpression can inhibit the cell growth. The expression of GLOD4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | GLOD4-shRNA-Seq1 |
Related Target/Protein | GLOD4 |
Region | 3UTR |
TargetSeq | CCCTCTTACTTGCTTTCACAT |
NCBI RefSeq | NM_016080 |
Alternative Names | HC71; CGI-150; C17orf25 |
Titer | >1*10^10 GC/mL |
Related Diseases | Hepatocellular carcinoma |