shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(FAM171A1-shRNA-Seq3)(CAT#: AdV-SI0690WQ)
This product is a FAM171A1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The FAM171A1 gene is involved in the regulation of the cytoskeletal dynamics and plays a role in actin stress fiber formation. The expression of FAM171A1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | FAM171A1-shRNA-Seq3 |
| Related Target/Protein | FAM171A1 |
| Region | 3UTR |
| TargetSeq | GCGAGCTGAATGTGACTATTA |
| NCBI RefSeq | NM_001010924 |
| Alternative Names | APCN; C10orf38 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |
