shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(KCTD2-shRNA-Seq3)(CAT#: AdV-SI1420WQ)
This product is a KCTD2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. KCTD2, an adaptor of Cullin3 E3 ubiquitin ligase, suppresses gliomagenesis by destabilizing c-Myc. The expression of KCTD2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | KCTD2-shRNA-Seq3 |
Related Target/Protein | KCTD2 |
Region | CDS |
TargetSeq | CGGGACAATGAGAACAGAACT |
NCBI RefSeq | NM_015353 |
Titer | >1*10^10 GC/mL |
Related Diseases | Ischaemic Stroke and Alzheimer's Disease |