shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(C10orf27-shRNA-Seq2)(CAT#: AdV-SI1482WQ)

This product is a C10orf27-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C10orf27 gene encodes a protein that regulates thymic epithelial cell proliferation and thymus size. It has been identified as a ligand for the class I human leukocyte antigen (HLA-I) in thymus. The expression of C10orf27-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C10orf27-shRNA-Seq2
Related Target/Protein C10orf27
Region CDS
TargetSeq CACAGAGAAGAAGACATCGAA
NCBI RefSeq NM_152710
Alternative Names SPATIAL; TBATA
Titer >1*10^10 GC/mL
Related Diseases Multiple sclerosis (MS)
Target Gene
Gene ID 219793
Uniprot ID Q96M53

Related Products