shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(PRRC1-shRNA-Seq1)(CAT#: AdV-SI1180WQ)

This product is a PRRC1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. PRRC1 Belongs to the PRRC1 family. 5 isoforms of the human protein are produced by alternative splicing. The expression of PRRC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert PRRC1-shRNA-Seq1
Related Target/Protein PRRC1
Region CDS
TargetSeq CCCACCACTTGTTACTTCTAT
NCBI RefSeq NM_130809
Titer >1*10^10 GC/mL
Related Diseases Head and neck cancer
Target Gene
Gene ID 133619
Uniprot ID Q96M27

Related Products