shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(TMEM60-shRNA-Seq1)(CAT#: AdV-SI1233WQ)

Datasheet

This product is a TMEM60-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of TMEM60-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert TMEM60-shRNA-Seq1
Related Target/Protein TMEM60
Region CDS
TargetSeq GCTTTAACAGAACTCGGATAT
NCBI RefSeq NM_032936
Alternative Names DC32; C7orf35
Titer >1*10^10 GC/mL
Related Diseases Kidney function and chronic kidney disease
Target Gene
Gene ID 85025
Uniprot ID Q9H2L4

Related Products

Recombinant adenovirus, pU6-(Human hsa-mir-340), Overexpression (CAT#:AdV-GTOH0200WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(DHX8-shRNA-Seq1) (CAT#:AdV-SI1027WQ) Recombinant adenovirus, pU6-(Mouse SDF1 L36CA65C), Overexpression (CAT#:AdV-GTOH0006WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(KHDRBS1-shRNA-Seq4) (CAT#:AdV-SI0047WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Olfr1163-shRNA-Seq1) (CAT#:AdV-SI2865WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(1700065I17Rik-shRNA-Seq3) (CAT#:AdV-SI2663WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(TMEM156-shRNA-Seq1) (CAT#:AdV-SI1161WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(OR5A1-shRNA-Seq1) (CAT#:AdV-SI1624WQ)