shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(WBP2NL-shRNA-Seq1)(CAT#: AdV-SI3605WQ)

This product is a WBP2NL-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by WBP2NL gene may promote meiotic resumption and pronuclear development during oocyte fertilization. The expression of WBP2NL-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert WBP2NL-shRNA-Seq1
Related Target/Protein WBP2NL
Region CDS
TargetSeq CCCGAGGATTTCCACTTAGAA
NCBI RefSeq NM_152613
Alternative Names PAWP; GRAMD7
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 164684
Uniprot ID Q6ICG8

Related Products