shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(9330180L21Rik-shRNA-Seq1)(CAT#: AdV-SI3145WQ)

This product is a 9330180L21Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by 9330180L21Rik gene is part of various corepressor complexes mediates the recruitment of corepressor complexes to target genes, followed by chromatin compaction and repression of transcription. The expression of 9330180L21Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert 9330180L21Rik-shRNA-Seq1
Related Target/Protein 9330180L21Rik
Region CDS
TargetSeq CTACCTATTGACCTGGAGTTT
NCBI RefSeq NM_175254
Alternative Names Smr; Sfmbt; AA536974; 4930442N21Rik; Sfmbt1
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 54650
Uniprot ID Q9JMD1

Related Products