shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C030018G13Rik-shRNA-Seq1)(CAT#: AdV-SI3157WQ)

This product is a C030018G13Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by C030018G13Rik gene is component of the NALCN sodium channel complex, required for channel regulation. The expression of C030018G13Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert C030018G13Rik-shRNA-Seq1
Related Target/Protein C030018G13Rik
Region CDS
TargetSeq GCTCTCCAATCAACAGTCAGA
NCBI RefSeq NM_175510
Alternative Names UNC-80; Unc80; C230061B10Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 329178
Uniprot ID Q8BLN6

Related Products