shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C12orf48-shRNA-Seq2)(CAT#: AdV-SI0774WQ)

This product is a C12orf48-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C12orf48 is required to suppress inappropriate homologous recombination, thereby playing a central role DNA repair and in the maintenance of genomic stability. The expression of C12orf48-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C12orf48-shRNA-Seq2
Related Target/Protein C12orf48
Region CDS
TargetSeq GAGGGTGTAAATCCATCTGTT
NCBI RefSeq NM_017915
Alternative Names AROM; PARI; PARPBP
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular Carcinoma
Target Gene
Gene ID 55010
Uniprot ID Q9NWS1

Related Products