shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(CAMSAP1-shRNA-Seq2)(CAT#: AdV-SI0804WQ)
This product is a CAMSAP1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The CAMSAP1 encoded protein is a key microtubule-organizing protein that specifically binds the minus-end of non-centrosomal microtubules and regulates their dynamics and organization. The expression of CAMSAP1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | CAMSAP1-shRNA-Seq2 |
| Related Target/Protein | CAMSAP1 |
| Region | CDS |
| TargetSeq | GAAGAGGAGCTTGTGGCTATT |
| NCBI RefSeq | NM_015447 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hepatocellular Carcinoma |
