shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(CAMSAP1-shRNA-Seq2)(CAT#: AdV-SI0804WQ)

This product is a CAMSAP1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The CAMSAP1 encoded protein is a key microtubule-organizing protein that specifically binds the minus-end of non-centrosomal microtubules and regulates their dynamics and organization. The expression of CAMSAP1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert CAMSAP1-shRNA-Seq2
Related Target/Protein CAMSAP1
Region CDS
TargetSeq GAAGAGGAGCTTGTGGCTATT
NCBI RefSeq NM_015447
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular Carcinoma
Target Gene
Gene ID 157922
Uniprot ID Q5T5Y3

Related Products