shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(DDX3Y-shRNA-Seq1)(CAT#: AdV-SI0517WQ)
This product is a DDX3Y-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by DDX3Y is a member of the DEAD-box RNA helicase family and is thought to be involved in ATP binding, hydrolysis, RNA binding, and in the formation of intramolecular interactions. Mutations in this gene result in male infertility, a reduction in germ cell numbers, and can result in Sertoli-cell only sydrome. The expression of DDX3Y-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | DDX3Y-shRNA-Seq1 |
Related Target/Protein | DDX3Y |
Region | 3UTR |
TargetSeq | GCCAGCAGTATTCTTCAGTAA |
NCBI RefSeq | NM_004660 |
Alternative Names | DBY |
Titer | >1*10^10 GC/mL |
Related Diseases | Male infertility, Sertoli cell-only syndrome or severe hypospermatogenesis |