shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(FAM23B-shRNA-Seq1)(CAT#: AdV-SI0855WQ)

This product is a FAM23B-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of FAM23B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert FAM23B-shRNA-Seq1
Related Target/Protein FAM23B
Region CDS
TargetSeq CCTACCAAGGAACAAGGGCTA
NCBI RefSeq NM_001013629
Alternative Names FAM23A; TMEM236; bA16O1.2; bA162I21.2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 653567
Uniprot ID Q5W0B7

Related Products