shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Hemgn-shRNA-Seq1)(CAT#: AdV-SI3128WQ)

This product is a Hemgn-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Hemgn gene may regulate the proliferation and differentiation of hematopoietic cells. The expression of Hemgn-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Hemgn-shRNA-Seq1
Related Target/Protein Hemgn
Region CDS
TargetSeq CAAGAAGCAGTTGAACCTGAA
NCBI RefSeq NM_053149
Alternative Names NDR; EDAG; CT155; EDAG-1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55363
Uniprot ID Q9BXL5

Related Products