shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(NCRNA00207-shRNA-Seq2)(CAT#: AdV-SI0831WQ)

This product is a NCRNA00207-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of NCRNA00207-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert NCRNA00207-shRNA-Seq2
Related Target/Protein NCRNA00207
Region CDS
TargetSeq CAGAATCAGATGAAGACTCCT
NCBI RefSeq NM_001012986
Alternative Names LINC00207
Titer >1*10^10 GC/mL
Target Gene
Gene ID 388910

Related Products