shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Olfr169-shRNA-Seq1)(CAT#: AdV-SI3109WQ)

This product is a Olfr169-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Olfr169 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr169-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Olfr169-shRNA-Seq1
Related Target/Protein Olfr169
Region CDS
TargetSeq CACACTATGAACGAGGCGTTT
NCBI RefSeq NM_001011855
Alternative Names MOR273-3P
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 258158
Uniprot ID Q7TS53

Related Products