shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(OR4F3-shRNA-Seq6)(CAT#: AdV-SI2531WQ)

This product is a OR4F3-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The OR4F3 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR4F3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert OR4F3-shRNA-Seq6
Related Target/Protein OR4F3
Region CDS
TargetSeq CATTACTGGAAACATCCTCAT
NCBI RefSeq NM_001005224
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 26683
Uniprot ID Q6IEY1

Related Products