shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(LOC392563-shRNA-Seq2)(CAT#: AdV-SI2415WQ)
This product is a LOC392563-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by LOC392563 gene is a component of the mature neuronal cytoskeleton, and it interacts with the zygosome, which is mediated by neurofilament-related proteins. The expression of LOC392563-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | LOC392563-shRNA-Seq2 |
| Related Target/Protein | LOC392563 |
| Region | CDS |
| TargetSeq | CGCAGAACCATTACAGCGATA |
| NCBI RefSeq | XM_373382 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Neurodegenerative diseases |
