shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(RSBN1-shRNA-Seq1)(CAT#: AdV-SI0574WQ)

This product is a RSBN1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The RSBN1 gene specifically demethylates dimethylated 'Lys-20' of histone H4 (H4K20me2), thereby modulating chromosome architecture. The expression of RSBN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert RSBN1-shRNA-Seq1
Related Target/Protein RSBN1
Region CDS
TargetSeq CGATCTCAAGCACAAGGACAA
NCBI RefSeq NM_018364
Alternative Names KDM9; ROSBIN
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 54665
Uniprot ID Q80T69

Related Products