shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(SUN5-shRNA-Seq2)(CAT#: AdV-SI0572WQ)

This product is a SUN5-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SUN5 encoded by this gene appears to play a role in the meiotic stage of spermatogenesis. The encoded protein localizes to the junction between the sperm head and body and may be involved in nuclear envelope reconstitution and nuclear migration. Mutations in this gene have been implicated in acephalic spermatozoa syndrome. The expression of SUN5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert SUN5-shRNA-Seq2
Related Target/Protein SUN5
Region CDS
TargetSeq CTCATGGAGAAGACAGGCATT
NCBI RefSeq NM_080675
Alternative Names SPAG4L; SPGF16; TSARG4; dJ726C3.1
Titer >1*10^10 GC/mL
Related Diseases Acephalic spermatozoa syndrome
Target Gene
Gene ID 140732
Uniprot ID Q8TC36

Related Products